Contact Us Add to Favorite
 
NianQi Search Adv Search
33
Instruction for Submission
Instruction for Writing
Template
Author FAQs
 
Reviewers Policy
Reviewers FAQs
 
Instruction for Editors
Editors Reviewers FAQs
    Links
Links
More....  
    本期目录
2019 Vol. 27, No. 3  Published: 15 March 2019
 
Articles and Letters
Cloning, Expression and Functional Analysis of TRAF4 Gene in Nile Tilapia (Oreochromis niloticus)
HAN Xue-Qing, GAO Feng-Ying, LU Mai-Xin, LIU Zhi-Gang, CAO Jian-Meng, WANG Miao, YI Meng-Meng, ZHANG De-Feng
2019, 27(3): 381-392  | doi: 10.3969/j.issn.1674-7968.2019.03.001 |  Full text (HTML) (1 KB)  | PDF   PDF  (2839 KB)  ( 734 )
Abstract
Tumor necrosis factor receptor associated factors 4 (TRAF4) is a special member of the TRAFs family, and its biological functions are numerous and complex. In order to investigate the immune function of TRAF4 gene in Nile tilapia (Oreochromis niloticus), the cDNA sequence (GenBank No. MH986338) and genomic sequence of TRAF4 gene were obtained by reverse transcription PCR and fragment amplification. In addition, the biological information such as gene and protein structure were also analyzed. Then qRT-PCR was used to detect the tissue distribution of the gene in healthy individuals, the expression of the gene at different developmental stages after fertilization, and the expression characteristics of the gene after artificial infection with Streptococcus agalactiae. Finally, the recombinant eukaryotic expression vector was constructed to analyze the subcellular localization of TRAF4 in 293T human embryonic kidney cells and its role in nuclear factor κB (NF-κB) pathway. The results showed that the TRAF4 cDNA was 4 483 bp in length which contained an ORF of 1 413 bp encoding 470 amino acid residues. There were 7 exons and 6 introns among the genomic sequence. The putative protein of TRAF4 contained 3 characteristic domains conserved in the TRAF family, including 1 N-terminal RING-finger, 3 zinc-fingers and 1 C-terminal meprin and TRAF-homology (MATH) domain. To examine the basal expression of TRAF4, qRT-PCR analysis was carried out in brain, gill, liver, spleen, intestine, heart, kidney, stomach, skin, muscle, and blood. To eliminate the individual variation, 6 fishes were sampled and analyzed separately by qRT-PCR, and their mean values were considered. The results showed that the expression of TRAF4 was detected in all the examined tissues. And the highest expression level of TRAF4 was detected in brain, whereas the lowest expression was detected in spleen and blood. The expression at different developmental stages after fertilization was also detected and each assay was performed in triplicate. The results showed that the expression of TRAF4 was detected in all the developmental stages. qRT-PCR was also used for TRAF4 expression when Nile tilapia were challenged with Streptococcus agalactiae. In the infected fish gill and blood, TRAF4 gene expression significantly increased and reached its peak at 72 h post infection (hpi). However, the expression levels of TRAF4 in the intestine and kidney were all down-regulated when compared with their own control group (0 h group). The TRAF4 ORF was amplified and subcloned into the plasmid vector (pcDNA3.1/CT-GFP-TOPO®). Then the result of subcellular localization showed that TRAF4 protein distributed mainly in the cytoplasm, and overexpression of TRAF4 could significantly increase the NF-кB activity in 293T cells. The TRAF4 gene might play an important role in the immune response of Nile tilapia. This study provides basic data for further investigation of the TRAF4 gene and understanding anti-infective immune mechanism of Nile tilapia.
Obtainment and Characterization of Rice (Oryza sativa) OsDUF1475 Mutants Based on CRISPR/Cas9 Technique
KONG Xiao-Cong, PI Rui-Xue, SHI Yu-Lu, WANG Quan, JIN Ya-Jun, LIANG Shan-Shan, ZHANG Si-Ju, LUAN Wei-Jiang
2019, 27(3): 393-401  | doi: 10.3969/j.issn.1674-7968.2019.03.002 |  Full text (HTML) (1 KB)  | PDF   PDF  (2375 KB)  ( 622 )
Abstract
Domains of unknown function protein families (DUFs) are a large set of uncharacterized protein families, which play an important role in biological activities. To investigate biological function of the rice (Oryza sativa) DUF gene OsDUF1475, the CRISPR/Cas9 gene editing technique was employed. Two target sites on the first exon of the OsDUF1475 gene were selected and ligased into CRISPR/Cas9 vector to produce 2 recombinant vectors. Then, the 2 recombined plasmids were introduced into rice cultivar Nipponbare by Agrobacterium-mediated transformation method. Totally 65 T0 transgenic plants were obtained. Sequencing analysis of the target sites showed that there were 3 types of mutations in the transgenic plants, including single base insertions, short fragment deletions (<10 bp) and long fragment deletions (>10 bp). Analysis of the amino acid sequence showed that the frame shift of OsDUF1475 ORF were produced which resulted in truncated protein in editing mutants. The results indicated that the OsDUF1475 gene was edited successfully by CRISPR/Cas9 technique. And T1 generation homozygous mutant plants obtained by self-crossing showed that these mutants were genetically stable. Taken together, the mutants obtained in present study are suitable materials for OsDUF1475 function study.
Cloning and Expression Analysis of Disease-related Gene BcSGT1 in Non-heading Chinese Cabbage (Brassica rapa ssp. chinensis)
LIU Dong-Rang, HOU Xi-Lin, XIAO Dong
2019, 27(3): 402-410  | doi: 10.3969/j.issn.1674-7968.2019.03.003 |  Full text (HTML) (1 KB)  | PDF   PDF  (1821 KB)  ( 361 )
Abstract
SGT1 (suppressor of the G2 allele of skp1) as an important element for plant disease resistance, is involved widely in plant cell cycling, stress response, protein ubiquitination and signal transduction processes, and it plays an important role in plant disease resistance. In order to study the structure and expression characteristics of the disease-related gene BcSGT1 in non-heading Chinese cabbage (Brassica rapa ssp. chinensis), the full-length cDNA sequence of BcSGT1 gene was cloned from the resistant variety 'Suzhouqing' by RACE technique. The expression analysis of gene was used by qRT-PCR. The expression pattern of Peronospora parasitica and Alternaria brassicicola induced treatment conditions, sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) technique was used to analyze the prokaryotic expression characteristics for the gene. The analysis results of sequence indicated that the full-length cDNA of BcSGT1 gene was 1 418 bp, and the open reading frame was 1 074 bp in length, encoding a total of 358 amino acids. The relative molecular weight was 39.77 kD, and the protein theoretical isoelectric point was 5.05 (GenBank No. AB495003). The evolutionary analysis of amino acid homologous system showed that the BcSGT1 gene of the non-heading Chinese cabbage had similar evolutionary relationship with the same family plant, and the highest homology (97%) was found with the chromosome 3 gene of Brassica rapa (Bra000741). The qRT-PCR analysis showed that under the infection of P. parasitica, the expression level of BcSGT1 gene in the resistant variety 'Suzhouqing' peaked at the 24 h, while the expression level in the susceptible variety 'Aijiaohuang' reached the peak at the 48 h. The peak expression of BcSGT1 gene in the resistant variety 'Suzhouqing' was about 2.1 times higher than that in the susceptible variety 'Aijiaohuang' (P<0.01). With the infection of A. brassicicola, the expression level of BcSGT1 in 'Suzhouqing' reached its peak at 12 h, while the expression level in the susceptible variety 'Aijiaohuang' peaked at 24 h, and the peak expression of BcSGT1 gene in the resistant variety 'Suzhouqing' was about 2.0 times higher than the peak expression in the susceptible variety 'Aijiaohuang' (P<0.01). The expression level of BcSGT1 in 'Suzhouqing' is significantly higher than the expression level in 'Aijiaohuang' after 24 and 48 hours of infection by P. parasitica, and 12 h, 24 h, 48 h infection by A. brassicicola (P<0.01). The prokaryotic expression vector was induced by isopropyl β-D-thiogalactoside (IPTG) to express a fusion protein with a relative molecular mass of about 39 kD. The BcSGT1 gene of non-heading Chinese cabbage played an important role in the infection of P. parasitica and A. brassicicola, and BcSGT1 successfully achieved fusion expression in Escherichia coli, which provided the conditions for further protein level research and transgenic function research. It will also provide an important theoretical value for the selection of high-yield, high-quality and disease-related non-heading Chinese cabbage varieties.
Analysis of Transactivation Activity and Expression Characteristics of RhMYB96 in Rosa hybrida
DING Ai-Qin, LI Shao-Cui, LIU Qing-Chao, WANG Kui-Ling, LIU Qing-Hua, JIANG Xin-Qiang
2019, 27(3): 411-420  | doi: 10.3969/j.issn.1674-7968.2019.03.004 |  Full text (HTML) (1 KB)  | PDF   PDF  (2339 KB)  ( 3491 )
Abstract
External environment and internal gene regulation could influence the germplasm of Rosa hybrida genetic characteristics, and transcription regulation plays vital roles in these biological processes. To determine the biological function of R2R3-MYB (v-myb avian myeloblastosis viral oncogene homolog) transcription factors in rose, a new MYB transcription factor gene named as RhMYB96 (GenBank No. MF185658) was cloned from cut rose 'Samantha' based on the expressed sequence tags from transcriptome assembly and rapid amplification of cDNA ends (RACE) methods. The RhMYB96 ORF was 1 065 bp, which encoded 354 amino acids. Bioinformatics analysis showed that the molecular weight and theoretical isoelectric point of RhMYB96 was 39.49 kD and 6.89, respectively, and the formula was C1693H2655N519O548S14. Multiply protein alignment revealed that RhMYB96 contained 2 highly conserved domains R2-MYB and R3-MYB in its N terminus regions. The secondary structure of RhMYB96 was typical helix-turn-helix mode. In addition, the C terminal region of RhMYB96 and other plant MYB proteins were used to construct phylogenic tree. RhMYB96 had a close relationship with Arabidopsis AtMYB96, AtMYB94 and AtMYB30, which belonged to the R2R3-MYB proteins of subgroup 1. qRT-PCR results showed that the expression of RhMYB96 in rose petals was the highest when compared with other organs. In addition, salt stress and abscisic acid (ABA) treatment significantly increased the expression of RhMYB96. Meanwhile, salt stress plus ABA treatment significantly increased the expression of RhMYB96. Moreover, 6 recombinant plasmids in yeast cells, which contained different fragments of RhMYB96 were constructed. The transactivation analysis of RhMYB96 was also examined by yeast one hybrid-assays. The results showed that RhMYB96 was a transcriptional activator, and an activation domain located at the C terminus. The N terminal DNA-binding domain lost transcription activity. Above results showed that transactivator RhMYB96 might participate in salt stress response via ABA dependent pathway. The study provides a foundation for predicting the roles of RhMYB96 in transcription regulatory networks and inferring functions in molecular breeding of rose plant species.
Cloning and Expression Characteristics Analysis of CaERF109 and CaABR1 Gene in Canarium album
LAI Rui-Lian, CHEN Jin, FENG Xin, WANG Zhong, CHEN Yi-Ting, WU Ru-Jian
2019, 27(3): 421-430  | doi: 10.3969/j.issn.1674-7968.2019.03.005 |  Full text (HTML) (1 KB)  | PDF   PDF  (4258 KB)  ( 343 )
Abstract
Canarium album is one of the characteristic and precious fruit in tropical and subtropical regions of China. Generally, C. album is poor in cold resistance, thus, often suffers from low temperature freezing damage. Recently, accumulated evidences have revealed that APETALA2/ ethylene responsive factor (AP2/ERF) is closely related to growth and stress response of many plants. To investigate the regulatory functions of AP2/ERF transcription factors in C. album, two AP2/ERF gene superfamily members, named CaERF109 (GenBank No. MH670905) and CaABR1 (abscisic acid repressor 1, GenBank No. MH670906) were cloned from C album cv. Fulan-1 tree, and their bioinformatics and qRT-PCR expression patterns were performed in this study. The results showed that the ORF of CaERF109 and CaABR1 were 888 bp and 1 473 bp respectively, and predicted to encode 295 and 490 amino acids. Bioinformatics analysis showed that the codon biases level of CaERF109 and CaABR1 were low, and both of them encoded unstable hydrophobic basic proteins, contained ERF typical features that belonged to AP2/ERF transcription factor superfamily. Subcellular location prediction showed that CaERF109 and CaABR1 located in mitochondrial matrix and peroxisomes respectively. According to qRT-PCR analysis, both CaERF109 and CaABR1 showed organ-specific expression patterns, and of which was highly expressed in root and leaf respectively. In addition, both genes were extremely significantly up-regulated with the decrease of temperature during cold stress (P<0.01). This research revealed that both CaERF109 and CaABR1 may play different regulation functions during development of organs, and involve in low temperature stress responses of C. album. This study could provide the theoretical foundation for molecular mechanism research of low temperature stress and cold resistance breeding in C. album.
Artemin Expression and Localization in Main Reproductive Organs and Parthenogenetic Embryos of Yak (Bos grunniens)
WANG Jing-Lei, WANG Meng, PAN Yang-Yang, LI Qin, HE Hong-Hong, HU Xue-Quan, HAN Xiao-Hong, FAN Jiang-Feng, CUI Yan, YU Si-Jiu
2019, 27(3): 431-440  | doi: 10.3969/j.issn.1674-7968.2019.03.006 |  Full text (HTML) (1 KB)  | PDF   PDF  (6324 KB)  ( 347 )
Abstract
Artemin (ARTN) is a member of the glial cell line-derived neurotrophic factor (GDNF) ligand family, expressed in a variety of mammalian reproductive tract and early embryo development, and involved in early embryonic developmental regulation. But the presence of Artemin in the main reproductive organs and embryos of the yak (Bos grunniens) is unknown. In order to explore the biological effects of Artemin in female yak reproductive regulation and early embryo development under normal physiological conditions, this study collected the main reproductive organs (ovary, uterus, fallopian tubes) of female yak at different stages (follicular phase, luteal phase, and pregnancy) and produced parthenogenetically activated embryos. qRT-PCR was used to detect the expression of Artemin gene during tissue and embryonic development. Western blot(WB), immunohistochemistry and immunofluorescence staining were used to analyse the Artemin expression level and localization in various reproductive organs and embryos. The results showed that Artemin was expressed in the main genital organs and parthenogenetic embryos of yak. The expression of Artemin in the luteal phase and the oviduct during pregnancy was higher than that in the follicular phase. The expression of Artemin in the uterus during follicular phase and pregnancy was higher than that in the luteal phase. The levels of Artemin mRNA in embryos were higher than that in main genital, which were highest in morula, followed by 4~8-cell embryos and blastocyst , and were lowest in 2-cell embryos. Immunohistochemistry results showed that Artemin was expressed in the oviductal mucosa epithelium, follicular membrane, ovarian reproductive epithelium, luteal cells, endometrium and uterine glands. Immunofluorescence staining showed that Artemin was expressed in the trophoblast of the yak blastocyst. These results showed that Artemin was involved in the regulation of yak estrous cycle and early embryo development. This study provides basic data for further exploration of the mechanism of action of Artemin, which contributes to the improvement of in vitro culture techniques of yak embryos and the improvement of yak breeding ability.
HMOX1 Gene Expression and Assiciation Between Its Polymorphism and Hypoxia Adaptation in Tibetan Sheep (Ovis aries)
HE Jian-Wen, ZHANG Wei, LIU Xiu, LI Shao-Bin, WANG Ji-Qing, HU Jiang, LUO Yu-Zhu
2019, 27(3): 441-448  | doi: 10.3969/j.issn.1674-7968.2019.03.007 |  Full text (HTML) (1 KB)  | PDF   PDF  (1886 KB)  ( 1727 )
Abstract
Heme oxygenase 1 (HMOX1) is a stress-inducible enzyme of the heme oxygenase family. HMOX1 plays an important role in the metabolic regulation of hypoxia stress in the body. Tibetan sheep (Ovis aries)have developed a unique hypoxic adaptation strategy during long-term evolution to maintain their own oxygen balance. In order to investigate the relationship between HMOX1 expression and Exon3 polymorphism and hypoxia adaptation in Tibetan sheep, look for molecular markers relating to hypoxia adaptation, this study used Tibetan sheep and Hu sheep (control group) at different altitudes, the expression of tissues and the genotype polymorphisms in exon3 of HMOX1 gene were detected by qRT-PCR and PCR-single-strand conformation polymorphism (PCR-SSCP), and the associations of different genotypes and alleles with blood parameters of sheep were analyzed. Sexuality and the correlation between different genotypes of single polymorphic loci and blood parameters of sheep were analyzed. The results showed that HMOX1 was expressed in tissues of Tibetan sheep and Hu sheep. In Tibet sheep, the gene was highly expressed in spleen (P<0.01), followed by liver, kidney and longissimus dorsi muscle (P<0.05). In Hu sheep, the gene was highly expressed in lung and fat (P<0.01), followed by liver, kidney and spleen (P<0.05). The expressions of HMOX1 gene in lung and fat tissue were significantly different between Tibetan sheep and Hu sheep (P<0.01). Four SNPs loci and 3 alleles of A, B and C were detected in the Exon3 region of HMOX1 gene. By comparing different genotypes between the two varieties, the hemoglobin (HGB) and hematokrit (HCT) values of AB Hu sheep were significantly lower than those of Tibetan sheep (P<0.01). The HGB and HCT values of BB individuals were significantly higher than those of AB (P<0.01), and the AC-type SO2 values were significantly higher than those of AA and BB individuals and c.3775G>A sites. The SO2, HGB and HCT values of MM genotypes in c.3775G>A locus were significantly higher than those of NN genotypes (P<0.05), which indicated that the C.3775G>A locus G of AA, BB and AC genotypes was more favorable for adaptation to hypoxic environment. Therefore, HMOX1 gene can be used as candidate gene.These results provide basic data for exploring the molecular mechanism of hypoxia adaptation in Tibetan sheep.
Association Analysis Between Polymorphism in the Exon 3 of LPL Gene and Meat Quality Traits in Ujimqin Sheep (Ovis aries)
GAO Hong-Meng, ZHANG Xiu-Ying, ZHANG Hui-Ze, HASI Qimuge, ZHOU Xu-Guang, WEI Jian-Min, YU Zhong-Zheng
2019, 27(3): 449-456  | doi: 10.3969/j.issn.1674-7968.2019.03.008 |  Full text (HTML) (1 KB)  | PDF   PDF  (1483 KB)  ( 1126 )
Abstract
Meat quality traits are important economic value in sheep (Ovis aries) breeding. Lipoprotein lipase (LPL) is known as an important enzyme in the metabolism of lipids and lipoproteins in animal organisms, which belongs to the lipase family. LPL is mainly synthesized and secreted by adipose cells, skeletal muscle cells, myocardial cells, mammary cells and macrophages. Enzyme activity is regulated by nutritional factors and hormone levels. The A384T single nucleotide polymorphism (SNP) exists in the exon 3 of sheep LPL gene, and this SNP has been confirmed to have a certain relationship with sheep meat quality traits. Ujimqin sheep is the most important breed of Mongolia sheep population with fat-tailed, high quality meat and carpet wool, and have sound body conformation, strong walking ability and admirable adaptation to very different ecological conditions. Recently, the mutton of Ujimqin sheep is widely recognized as natural green food in China. Thus, it is necessary to improve meat quality traits of Ujimqin sheep for developing mutton sheep industry. In this study, four hundred and twenty castrated male Ujimqin lambs which under the same feeding conditions were randomly selected as experimental samples. The A384T SNP was genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), and the effect of this SNP on meat quality traits and fatty acid content were analyzed. The aim of this study was to investigate the association between the A384T SNP and meat quality traits in Ujimqin sheep. The results showed that there were 3 different genotypes (TT, TA and AA) at the A384T SNP site in Ujimqin sheep population. The frequency of TA genotype was the highest (0.4714), and the frequency of AA genotype was the lowest (0.1595) in this experimental animal population. The T allele was the dominant allele in this population. The genotype frequency of the A384T SNP was consistent with Hardy-Weinberg equilibrium (P>0.05). The pH24 of individuals with TT genotype were significantly higher than those of TA and AA genotype (P<0.01). The drip loss of individuals with TT genotype were significantly higher than those of the TA and AA genotype (P<0.05). There were no significant differences among genotypes in other meat traits, including pH1, carcass weight, net meat weight, eye muscle area and drip loss (P>0.05). The contents of palmitic acid and stearic acid in muscle tissue of TT genotype were significantly lower than those of TA and AA genotype individuals (P<0.01). The contents of myristic acid in muscle tissue of TT genotype were significantly lower than those of TA and AA genotype individuals (P<0.05). There were no significant differences in the other fatty acid contents among 3 genotypes (P>0.05). These data showed that the A384T SNP in the exon 3 of the LPL gene was associated with meat quality traits of Ujimqin sheep, and could be an effective genetic marker for molecular breeding of Ujimqin sheep. These results provide scientific basis for genetic improvement of Ujimqin sheep.
Expression Analysis of MTR1a Gene in Hypothalamic-pitutary-ovarian Axis During Estrus Cycle in Ganjia Tibetan Sheep (Ovis aries)
YANG Da-Peng, HE Yu-Qin, GE Wen-Bo, ZHANG Quan-Wei, HUADAO Cai-Rang, WANG Xia, ZHOU Kai- Ren, CHEN Wei-Gang
2019, 27(3): 457-463  | doi: 10.3969/j.issn.1674-7968.2019.03.009 |  Full text (HTML) (1 KB)  | PDF   PDF  (1639 KB)  ( 342 )
Abstract
Melatonin is a steroid hormone secreted by the pineal gland. Its receptor binds to the hypothalamic-pituitary-ovarian axis (HPO) of female animals and plays a role in regulating the seasonal reproduction of animals. To describe the expression pattern of the HPO axis of the estrus cycle melatonin receptor 1a (MTR1a) in Ganjia Tibetan sheep (Ovis aries), 32 healthy Ganjia Tibetan sheep were selected in the erotic cycles, and detected the differential expression of melatonin receptor 1a (MTR1a) in Ganjia Tibetan sheep hypothalamus, pituitary and ovarian tissues of plateau in estrous cycle by using qRT-PCR assays. The results showed that MTR1a was expressed in HPO tissues with entire estrous cycles. In the pre-estrus, estrus, late estrus, and inter-temporal hypothalamic tissue of Ganjia Tibetan sheep, the relative expression of MTR1a gene in hypothalamic tissue was the highest in proestrus, which was significantly higher than that in estrus and late estrus (P<0.01). At the same period, the relative expression of MTR1a gene in pituitary tissue was the highest in diestrus, which was significantly different from estrus (P<0.05); The relative expression of MTR1a in ovarian tissue was the highest in proestrus, which was significantly higher than the other three periods (P<0.01). Taken together, this study found that MTR1a in different stages with estrous cycle was expressed in HPO tissues, and the expression levels had dynamic variation. These results indicated that MT had a regulatory role for Tibetan sheep reproductive activities. This study provides a scientific basis for MT regulation of sheep reproductive performance in molecular level.
Association Analysis of the SINE Insertion Polymorphism in VRTN Gene with Growth and Reproductive Traits in Pig (Sus scrofa domesticus)
CHEN Wei, CHEN Cai, WANG Xiao-Yan, ZHANG Li, WANG Wei, SHEN Dan, WANG Sai-Sai, GAO Bo, SONG Cheng-Yi
2019, 27(3): 464-470  | doi: 10.3969/j.issn.1674-7968.2019.03.010 |  Full text (HTML) (1 KB)  | PDF   PDF  (2826 KB)  ( 282 )
Abstract
The VRTN (vertebrae development associated) gene is an important regulatory gene for animal vertebrae development. Studies have shown that there is a short interspersed repeated sequence (SINE) insertion polymorphism in the VRTN gene of the porcine (Sus scrofa domesticus), which may be associated with the number of pig spines. In this study, the distribution of SINE insertion polymorphism in different pig breeds and its effects on growth and reproduction traits of pigs were studied by PCR detection, polymorphism correlation and bioinformatics analysis. The results showed that the frequency of SINE+ in introduced breeds was higher than that of cultivated pig breeds and Chinese local pig breeds. The age at 100 kg body weight of SINE+/+ pigs of Yorkshire was significantly higher than that of SINE-/- pigs (P<0.05), and the SINE+/+ pigs loin eye muscle area was significantly lower than that of SINE-/- pigs (P<0.05). There was no significant association between reproductive traits such as live litter size and SINE insertion polymorphism. SINE and VRTN genes were not found to form a fusion transcript after comparison with expressed sequence tag (EST). This study demonstrated that SINE insertion polymorphism in VRTN gene may be associated with pig growth rate and lean meat rate, which provided a reference for the application of this molecular marker in pig molecular breeding.
Construction of Eukaryotic Expression Vector of FGF10 Gene and Its Expression in Different Tissues of Congjiang Xiang Pig (Sus scrofa)
XU Min, XU Hou-Qiang, YANG Yang, CHEN Wei
2019, 27(3): 471-480  | doi: 10.3969/j.issn.1674-7968.2019.03.011 |  Full text (HTML) (1 KB)  | PDF   PDF  (2885 KB)  ( 518 )
Abstract
The fibroblast growth factor 10 gene (FGF10) is a member of the fibroblast growth factor family, belonging to the FGF7 subfamily of six subfamilies of FGFs, it is the only FGF specifically expressed in white adipose tissue, and plays an important role in the development and metabolism of adipose tissue. The purpose of this study was to investigate the regulation of fat metabolism of FGF10 gene in the intramuscular preadipocytes of Congjiang Xiang pig (Sus scrofa), and the function of FGF10 in regulating fat deposition was revealed. The qRT-PCR was used to detect the relative expression level of FGF10 gene in different tissues of Congjiang Xiang pig. According to the CDS region of the cloned FGF10 gene, the expression vector pEGFP-C1-FGF10 was constructed. The intramuscular preadipocyte cells had been digested by type collagenase. The oil red O staining method was used identification after induction culture. qRT-PCR was used to detect the expression of FGF10 gene in precursors adipocytes in the intramuscular preadipocytes of Congjiang Xiang pig at different induction stages. The recombinant plasmid pEGFP-C1-FGF10 was transfected by liposome method in the intramuscular preadipocytes of Congjiang Xiang pig, and then detected the expression levels of peroxisome proliferator activated receptor γ gene (PPARγ), adiponectin gene (ADIPOQ), fatty acid binding protein 4 gene (FABP4), fatty acid synthase gene (FAS), adipose triglyceride lipase gene (ATGL), lipoprotein lipase gene (LPL), hormone-sensitive lipase gene (HSL)and acetyl-CoA carboxylase gene (ACC) after overexpression of FGF10. The results showed that the extremely higher expression levels of FGF10 gene in the stomach and significantly higher than other tissues (P<0.05), followed by high expression in the kidney and fat, which were the lowest in the dorsal longest muscle. At the early stage of induction, the expression level of FGF10 gene gradually increased, and the expression level of FGF10 gene was the highest at the induction and differentiation of 48 h. The pEGFP-C1-FGF10 expression vector was successfully constructed by double enzyme digestion and sequencing, and was successfully expressed in the intramuscular preadipocytes of Congjiang Xiang pig. Compared with blank controls, the expression levels of ACC, FABP4, FAS, LPL, and PPARγ gene had all increased, while the expression levels of ADIPOQ, ATGL, and HSL gene had all decreased. The results of this study showed that FGF10 gene had certain regulation effect on the fat deposition, this study provides basic data for revealing FGF10 gene's regulation of fat metabolism.
Study on Variations and Transcriptional Activity of Osteocalcin Gene Promoter in laying hens (Gallus gallus domesticus)
WANG Han, CHEN Ye, YUE Qiao-Xian, ZHOU Rong-Yan, CHEN Hui, WANG De-He, XI Jian-Zhong
2019, 27(3): 481-487  | doi: 10.3969/j.issn.1674-7968.2019.03.012 |  Full text (HTML) (1 KB)  | PDF   PDF  (1421 KB)  ( 334 )
Abstract
Osteocalcin (OCN) is a kind of non-collagen bone matrix protein secreted and synthesized by osteoblasts, which plays an important role in bone metabolism such as bone remodeling and bone mineralization. This study aimed to investigate the mechanism of gene expression regulation of OCN in laying hens (Gallus gallus domesticus). Twenty 50-week-old DAWUFEN laying hens were selected and the blood was collected for DNA extraction. The primers for promoter region of OCN gene were designed according to the template sequence downloaded from Ensembl database (ENSGALG00000029494). Potential genetic variations in the promoter region of OCN gene were identified by Sanger sequencing. JASPAR2018 was used for transcription factors binding site prediction. The luciferase reporter gene recombinant vectors with different haplotypes were constructed and the dual-luciferase activity was detected by transfecting chicken fibroblast line DF-1. The results showed that the promoter region of the OCN gene in the amplified layer had the transcriptional activity and contained binding sites for bone metabolism-related transcription factors such as Vitamin D receptor (VDR), Runt related transcription factor (RUNX) 1, RUNX2, and RUNX3. Sequencing results revealed the presence of the insert fragment CCGCACTCTGCACTTTGCGGCCG and the deletion fragment CCACA in promoter region, as well as C>G and A>G variations. These variants constituted 4 haplotypes. The dual luciferase assay showed that all the 4 haplotypes in the promoter region had transcriptional activity, but the activity of different haplotypes had extremely significant difference (P<0.01), and the transcriptional activity of haplotype was the highest. In this study, the core promoter region of the OCN gene was identified, and there were differences in the promoter transcriptional activities of different haplotypes. A theoretical basis for the transcriptional regulation of OCN gene could be helpful for bone metabolism of laying hens.
A Single Dose of Recombinant Adenovirus Boosts BCG-primed Specific T Cell Immune Response in Mice (Mus musculus)
LI Wu, DENG Guang-Cun, LIU Xiao-Ming, WANG Yu-Jiong
2019, 27(3): 488-494  | doi: 10.3969/j.issn.1674-7968.2019.03.013 |  Full text (HTML) (1 KB)  | PDF   PDF  (1859 KB)  ( 322 )
Abstract
Tuberculosis (TB) is a fatal disease that is caused by Mycobacterium tuberculosis (Mtb). Mycobacterium bovis Bacillus Calmette Guerin (BCG) has been widely used as the unique vaccine for TB prevention for many years, though its protective efficacy against Mtb infection is limited. The development of better vaccines and vaccination strategies to prevent the global spread of Mtb infection is therefore urgently needed. Previous studies had demonstrated that a recombinant adenoviral vector Ad5-CEAB was able to induce robust antigen-specific immune responses in mice (Mus musculus). In this study, antigen-specific lymphocyte proliferation test, interferon-γ enzyme-linked immunospot assay (INF-γ ELISPOT), flow cytometry analysis of splenocytes as well as cytokines enzyme linked immunosorbent assay (ELISA) were used to examine antigen-specific cellular immunological effects of Ad5-CEAB in the mice primed with BCG and boosted with a single dose of the recombinant adenovirus Ad5-CEAB. Female mice of ICR between 6 and 8 weeks of age were randomly divided into 4 groups (8 mice per group), mice in the control groups were injected subcutaneously with phosphate buffer saline (PBS) or with 1×106 CFU of BCG, while mice in the experimental groups were primed subcutaneously with 1×106 CFU of BCG and then intranasally boosted with 1×109 PFU of Ad5-CEAB once or twice. The mice were euthanized 2 weeks after the final immunization for analysis of T cell immune responses.The results displayed significantly elevated splenic T cell proliferation in mice of BCG/Ad5-2 group, BCG/Ad5-1 group and BCG group as compared to the PBS control group (P<0.05). In addition, the results of IFN-γ-ELISPOT also showed a dramatically increased frequency of Mtb antigen-specific IFN-γ-secreting splenic T cells in mice immunized with BCG or BCG/Ad5-CEAB as compared to the PBS-treated mice (P<0.05). The frequencies of CD4+ and CD8+ T cell populations were higher in these immunized mice relative to the PBS-treated group (P<0.05). Noticeably, the above examined indexes of immune responses in mice immunized with one dose of BCG priming and one dose of Ad5-CEAB boosting (BCG/Ad5-1 group) were statistically greater than that in the BCG group and the PBS group (P<0.05). Furthermore, the results of cytokines ELISA showed that significantly elevated antigen-induced cytokines interleukin-2 (IL-2) and tumor necrosis factor-α (TNF-α) were found in the BCG/Ad5-1 and BCG/Ad5-2 groups as compared to the BCG and PBS groups (P<0.05). Noticeably, there was no difference in the tested cytokines between the BCG prime-recombinant adenovirus boost groups (P>0.05), an indication that a single dose of recombinant adenovirus boost can effectively stimulate antigen-specific cytokines responses in mice as compared to the BCG alone.These data clearly demonstrate that the single dose of mucosal Ad5-CEAB boost is efficient in stimulating a stronger antigen-specific T cell response in BCG-primed mice as compared to the BCG group as well as PBS control group. Collectively, the results in this study showed that the heterologous prime-boost strategy that subcutaneously primed with BCG and intranasally boosted with a single dose of Ad5-CEAB could elicit robust antigen-specific cellular immune responses in mice. These results provide an additional insight into developing novel Ad-basis TB vaccines and novel mucosal-targeted prime-boost anti-TB vaccination strategies.
Phylogenetic Classification of Chitinases in Cotton Bollworm (Helicoverpa armigera), Expression and Analysis of Enzymatic Characterization on Group Ⅶ Chitinase
ABUDUNASIER Maimaitiailii, LI Meng-Ge, BAO Jing, SUI Hui, LIU Xiao-Ning*
2019, 27(3): 495-503  | doi: 10.3969/j.issn.1674-7968.2019.03.014 |  Full text (HTML) (1 KB)  | PDF   PDF  (3392 KB)  ( 335 )
Abstract
Insect chitinases are mainly involved in important physiological growth processes such as molting, degradation of peritrophic membranes, cell proliferation and immune defense. In this study, seven chitinases from Helicoverpa armigera and other insect chitinases sequences were downloaded from NCBI. Their domains and constructed phylogenetic tree were analyzed. The results showed that 6 of chitinases belonged to group Ⅰ, Ⅱ, Ⅲ, Ⅳ, Ⅶ and Ⅷ chitinase, respectively, and 1 chitinase belonged to the new group. Group Ⅶ chitinase (HaCHTⅦ) was rarely reported, It was cloned in this study. Fusion protein His-HaCHTⅦ was expressed in Escherichia coli transetta (DE3) and purified. The degradation activity of fusion protein against colloidal chitin and N-acetylated chitobiose was determined. Results showed that His-HaCHTⅦ had no degradative activity on colloidal chitin, and had the degradative activity on N-acetylchitobiose. The optimum reaction pH value and temperature condition was at 7 and 25℃, respectively. The kinetic parameter of michaelis constant (Km) and maximum speed (Vmax) were 0.486 2 mmol/L and 2.715 1 µg/(mL·min), respectively. Therefore, HaCHTⅦ was probably to degrade oligosaccharides to N-acetylglucosamine in H. armigera and then provided substrate to synthesize the new chitin component in the development and growth. Present findings may lead us to a better understand of the function of the group Ⅶ chitinase from H. armigera and may provide useful information for pest control.
Function Analysis of Flagellin Gene flgM in Acidovorax citrulli
YANG Bing-Ye, HU Fang-Ping, CAI Xue-Qing
2019, 27(3): 504-515  | doi: 10.3969/j.issn.1674-7968.2019.03.015 |  Full text (HTML) (1 KB)  | PDF   PDF  (7465 KB)  ( 432 )
Abstract
Bacterial fruit blotch (BFB) caused by Acidovorax citrulli (Ac) is one of the most important destructive seed borne diseases on watermelon (Citrullus lanatus) and melon (Cucumis melo) in the world and the cause pathogen is a worldwide quarantine pest. This disease causes serious economic loss to watermelon production. In order to effectively control the disease, The pathogenicity mechanism of A. citrulli on watermelon is needed to know. Flagellum is a movement organ of bacteria and plays an important role in bacterial infection. Alterative anti-sigma factor flgM, required in the regulation of flagellar gene transcription, has been verified in different bacteria species, but its feature in A. citrulli is unclear. The objective of this study is to understand the function of gene flgM on flagellum formation and pathogenicity of A. citrulli. The flgM gene deletion mutant was generated by homologous recombination with the help of suicide plasmid pK8mobsacB. Morphological characteristics have been tested of the flagella, pathogenicity, hypersensitive response, motility, quorum sensing, biofilm formation, growth rate, twitching, etc. among the wild type, the mutant and the complementary strain. Moreover, a real-time quantitative PCR (qRT-PCR) was carried out to compare the expression of genes, flhD, fliE, fliC, flgK, flgA, fliS, fliD and fliA in the wild type strain, the deletion mutant strain and the complementary strain using glutathiamide synthetase gene (glnA) as a reference. The results showed that the deletion mutant FJAc01-flgM and complementary strain FJAc01-flgMhb were generated successfully after gentamicin resistant screening and verified by PCR. Compared to wild type strain, the deletion mutant did not grow flagella and greatly attenuated in biofilm, motility, colonial morphology and the virulence on watermelon, but significantly accelerated in growth rate, which could be restored in the complementary strain. After 5 d of stabbed inoculation on watermelon fruit and spray inoculation on watermelon seedling, the disease indexes were 74.67 and 26.39 respectively inoculated by wild type strain FJAc01, but the disease indexes were 46.00 and 2.78 respectively by the deletion mutant strain FJAc01-flgM, and the disease indexes were 63.85 and 20.83 respectively by the complementary strain FJAc01-flgMhb. Whereas, there are no significant changes of mutant in hypersensitive response on tobacco (Nicotiana benthamiana), quorum sensing and pathogenicity to melon compared to the wild type strain. The wild type strain could form typical haloes obviously which caused by bacteria migrating via twitching on NA medium, but the deletion mutant weakened this ability and the complementary strain recovered the ability partially. The results of qRT-PCR indicated that the expression of flgK, fliA, fliE genes were up regulated, whereas flhD, fliC, fliS genes were down regulated in the mutant strain, and the expressions of these genes were recovered in the complementary strain. However, the expressions of gene flgA and fliD were not significant changed in the mutant. In conclusion, the flagellar gene flgM could regulate the flagellum formation, pathogenicity, biofilm formation, motility, growth rate and colony morphology of A. citrulli.
Construction of scFv Antibody for the Determination of Cry1A Toxins and Preliminary Study on Their Interaction Difference
QU Ting-Ting, ZHANG Xiao, DONG Sa, LIU Bei-Bei, LI Pan, WANG Yun, ZHANG Cun-Zheng, LIU Xian-Jin
2019, 27(3): 516-525  | doi: 10.3969/j.issn.1674-7968.2019.03.016 |  Full text (HTML) (1 KB)  | PDF   PDF  (4266 KB)  ( 424 )
Abstract
To establish a cost-effective detection method for Cry1 toxins, a hybridoma cell line 2D10 was used as a cDNA template to construct a single-chain antibody (scFv) gene via gene splicing by overlap extension PCR (SOE-PCR). After being transferred into Escherichia coli BL21 (DE3), the scFv gene was expressed and a double antibody sandwich ELISA (DAS-ELISA) was established. Meanwhile, the key factors affecting the interaction of scFv to Cry1A toxins were analyzed by molecular docking simulation. As a result, the scFv gene was successfully constructed and the scFv antibody with high activity was purified (about 28 kD). The minimum detection limit (LOD) of the established DAS-ELISA for Cry1Ab/Cry1Ac toxin was 20 ng/mL. The docking results showed that the three-dimensional structure of the toxin determined its binding activity, hydrogen bonds and hydrophobic interaction played an important role during the binding process between scFv and Cry1A toxins. In this study, a scFv was constructed and expressed based on genetic engineering antibody technology, a DAS-ELISA was established for Cry1Ab/Cry1Ac toxin determination and the recognization mechanism difference of scFv to Cry1Ac/Cry1Ab and Cry1Aa was preliminarily analyzed which provide a theoretical basis for the research and development of a new broad-spectrum scFv.
Degradation Characteristics of Corn (Zea mays) Straw by Bacillus amyloliquefaciens
YANG Juan, WANG Yan, CAI Yun-Hua, LI Hong-Ya, LI Shu-Na, WANG Shu-Xiang, WANG Quan
2019, 27(3): 526-533  | doi: 10.3969/j.issn.1674-7968.2019.03.017 |  Full text (HTML) (1 KB)  | PDF   PDF  (5995 KB)  ( 372 )
Abstract
Degradation of corn (Zea mays) stover by microbial fermentation technology is of great significance for realizing the resource utilization of cellulosic biomass. In this study, based on the isolation of a cellulose-degrading strain of Bacillus amyloliquefaciens MN-13 in the early stage of our research group, the cellulase activity of the strain and the degradation characteristics of corn stalk cellulose were further investigated, and while the degradation products of cellulose in stalk were analyzed by gas chromatography-mass spectrometer (GC/MS). The aim of this study is to provide basic data for the process regulation of corn stover fermentation by B. amyloliquefaciens MN-13. The results showed that B. amyloliquefaciens MN-13 could produce cellulases, in which the enzyme activity of filter paper cellulase (total cellulase) reached a maximum of 8.35 U/mL at 60 h in the cellulose-MSM (mineral salt medium) fermentation culture. In the fermentation process of corn stalk cultivated with strain MN-13, the hemicellulase activity reached a maximum of 60.46 U/g at 10th day, and the cellulase activity reached a maximum of 45.40 U/g at 14th day of fermentation. The content of soluble sugar reached the highest level and tended to be stable after fermentation for 19 d. After 24 d of fermentation, the damaged structure of corn stalk was obviously observed, and the degradation rate of cellulose and hemicellulose reaches to 27.12% and 40.6%, respectively. The degradation products mainly contained monosaccharides, alcohols and short-chain fatty acids. The results of this study provide an experimental basis for the study of the process of fermenting corn stalks by Bacillus amyloliquefaciens.
Reviews and Progress
Progress on Lin28 in the Regulation of Mammal Reproduction
CAO Gui-Ling, JIANG Yun-Liang, CHU Ming-Xing
2019, 27(3): 534-541  | doi: 10.3969/j.issn.1674-7968.2019.03.018 |  Full text (HTML) (1 KB)  | PDF   PDF  (1477 KB)  ( 1421 )
Abstract
Lin28a and Lin28b, as RNA-binding proteins, bind to the terminal loop of pri- and pre-let-7 miRNA and repress their processing; also bind to target mRNA to modulate their translation, and mediate several physiological processes, such as cell pluripotency maintenance, tumorigenesis and glucose metabolism. Some new researches discovered that Lin28a and Lin28b may participate in human and animal reproduction, and the action mechanisms remain ill defined. The present paper reviews the research progress on the role of Lin28a and Lin28b genes in onset of mammalian puberty, primordial germ cell (PGCs) formation and gametogenesis, and provide some reference for further studies on their roles in animal reproduction.
Resources and Updated Technology
Identification of Chromosomal Ploidy and DNA Content in Xinjiang Armeniaca vulgaris by Flow Cytometry
LI Wen-Wen, LIU Li-Qiang, PAMIER Ai-Ni, WANG Ya-Nan, CHENG Gong, LIAO Kang
2019, 27(3): 542-550  | doi: 10.3969/j.issn.1674-7968.2019.03.019 |  Full text (HTML) (1 KB)  | PDF   PDF  (1517 KB)  ( 892 )
Abstract
The wild apricot (Armeniaca vulgaris) distributed in Yili Valley of Xinjiang, China, is a relic community of the Tertiary warm temperate broad-leaved forest. It has a vast distribution area, large seedling population and abundant genetic diversity. In this study, different materials (young leaves and old leaves) of wild apricot were treated by different preservation methods (fresh, refrigerated, liquid nitrogen preservation). Using Medicago sativa as external standard, the cell ploidy and DNA content of wild apricot were determined by screening and optimizing 10 common dissociation solutions through flow cytometry (FCM). The results showed that the optimum mixture of MgSO4 buffer (MgSO4) and Lysis buffer (LB01) was used to detect the fresh tender leaves, and its coefficient of variation (CV) was the lowest, and the sample rate was 150 events/μL. Aging leaves could not produce a clear main peak. The CV value of samples increased with the increase of cold storage time. The CV value of young leaves within 4 d cold storage was less than 5%. The CV value of the cell nuclear suspension prepared by the old leaves and liquid nitrogen leaves was higher, showing a peak of poor resolution and more background fragments. The results showed that 20 populations of 2 populations of A. vulgaris were diploid and the content of DNA was 288~321 Mb/C. Fresh young leaves or tender leaves in cold storage within 4 days are ideal materials for FCM. The optimized mixture of MgSO4-LB01 was the best dissociation solution for apricot. FCM could be used to detect ploidy and DNA content of apricot plants quickly and accurately. The results of this study provide technical support for ploidy breeding and omics research of apricot plants. The ploidy and DNA content of wild apricot in Xinjiang are preliminarily discussed, which provide important information for the future study of molecular genetics and cytogenetics.
Establishment and Application of TaqMan Fluorescence Quantitative PCR Detection Method for Dickeya dadantii
SHEN Xiao-Ling, YI Jian-Ping, WANG Rong-Zhou, QIAN Jun-Ting, LI Yan-Min, YAO Hai-Feng, LOU Bing-Gan
2019, 27(3): 551-563  | doi: 10.3969/j.issn.1674-7968.2019.03.020 |  Full text (HTML) (1 KB)  | PDF   PDF  (4600 KB)  ( 403 )
Abstract
Bacterial stem and root rot caused by Dickeya dadantii is proved to be a serious disease, which is harmful to sweet potato (Ipomoea batatas) production. It can damage the stems, leaves, petioles and seed tubers, infecting and forming brown water-stained lesions. Now, the disease occurs in Zhejiang, Guangdong, Heibei, Henan and other provinces. Long-distance transportation of the seed tuber and germchit are the main way to spread the disease to the disease-free zone. Therefore, strict quarantine measures are the key to ensure healthy production in disease-free areas.An accurate, sensitive and rapid detection method is a powerful tool to guarantee strictly quarantining and insurance for researching on the occurrence of disease epidemics. Compared with closely related species, the flagellin protein gene (fliC) sequence of D. dadantii encoding the flagellin with high specificity which makes it to be a suitable target for molecular detection. With the fliC gene as the target, specific primers and TaqMan probes were designed, thus the method for fluorescence quantitative PCR detection (TaqMan qRT-PCR) of D. dadantii was established in this study. The method showed good specificity against D. dadantii based on the test results, and it could be effectively distinguished from bacteria of different species in the same genus and different genera. The method had high sensitivity and the detection sensitivity of the bacterial DNA was up to 280 fg/μL, which was 1 000 times of that of routine PCR. The detection sensitivity of bacterial liquid was up to 2 CFU/μL (CFU: colony forming units), the sensitivity was 100 times higher than the routine PCR detection method. Using NGM (nematode growth medium) to isolate suspected sweet potato stem and root rot samples, it was found that D. dadantii could form dark brown to blue colonies on the medium, which could significantly improve the efficiency of separation and purification of pathogenic bacteria. The actual samples were tested on 70 sweet potato and soil samples using the constructed TaqMan qRT-PCR method, routine PCR method and separation culture method based on NGM medium. Results showed that the positive detection rates of TaqMan qRT-PCR, routine PCR, and isolation culture method were 91.4%, 77.1%, and 71.4%, respectively. TaqMan qRT-PCR detection was more accurate, and the detection time was shortened from 96 h to 1.5 h. It could be seen that the quantitative PCR detection system based on TaqMan probe established in this study coul d be effectively used for rapid detection of suspected samples of sweet potato stem and root rot, diseased bodies, field soil, seed tuber and seedlings, and provided a fast and accurate molecular detection method of sweet potato stem and root rot for inspection and quarantine department, which was of great significance for effectively controlling the spread of the disease. This method can also be used for the quantitative detection of the pathogenic bacteria of sweet potato stem and root rot in suspect samples, providing technical support for studying the relationship between the population of pathogenic bacteria and disease severity in soil.
Establishment of a MGB TaqMan Probe-based Real-time Quantitative PCR Detection Method for Duck (Anas platyrhynchos domestica) Adenovirus Type 3
CHEN Cui-Teng, CHEN Zhen, ZHU Chun-Hua, CAI Guo-Zhang, LIU Bing-Qiong, HUANG Yu
2019, 27(3): 564-570  | doi: 10.3969/j.issn.1674-7968.2019.03.021 |  Full text (HTML) (1 KB)  | PDF   PDF  (1617 KB)  ( 514 )
Abstract
Duck (Anas platyrhynchos domestica) adenovirus type 3 (DAdV-3) is a newly discovered duck-derived adenovirus in recent years. In this study, specific primers and probe were designed based on the 22K gene characteristics of DAdV-3 representative strain (CH-GD-12-2014 strain, GenBank No. KR135164) in the NCBI database, and a MGB TaqMan probe real-time quantitative PCR method for detecting DAdV-3 was established. The results showed that the established qRT-PCR method had the following characteristics: High sensitivity, minimum detection limit of 55 copies/μL; Strong specificity, and no cross-reaction with common infectious disease pathogens in duck flocks; Good reproducibility, intra-group and inter-group repetitive experimental variation coefficients were 0.44%~2.10% and 0.64%~2.37%, respectively. 61 duck-derived materials were detected by the established method, and 15 positive DAdV-3 samples were detected with a positive rate of 24.6%. This study laid the foundation for rapid laboratory diagnosis and epidemiological investigation of DAdV-3 infection.
Copyright © Editorial Board of 农业生物技术学报
Supported by:Beijing Magtech